Journal: Applied and Environmental Microbiology

Article Title: Discovery of a Thermostable GH10 Xylanase with Broad Substrate Specificity from the Arctic Mid-Ocean Ridge Vent System

doi: 10.1128/AEM.02970-18

Figure Lengend Snippet: Domain architecture and phylogenetic analysis of the GH10 domain of AMOR_GH10A. (A) Domain architecture of AMOR_GH10A drawn to scale. The full-length enzyme contains a predicted signal peptide (SP; residues 1 to 18), followed by a putative CBM domain (residues 19 to 180) and a GH10 xylanase domain (residues 239 to 529). (B) Phylogenetic analysis of the GH10 domain. The tree was constructed using the maximum-likelihood method inferred by RAxML (v8.2.9). The numbers at the nodes indicate bootstrap values based on 1,000 bootstrap replications. The scale bar represents 1.0 amino acid substitutions per position.

Article Snippet: The amor_gh10a gene (codon optimized for E. coli expression) was synthesized by GenScript (Piscataway, NJ) and bp 55 to 1767 (omitting the predicted 18 amino acid signal peptide) was amplified by PCR using Q5 DNA polymerase (New England Biolabs, Ipswich, MA) and forward primer 5′- TTAAGAAGGAGATATACTATG GCTGAACCACAAGTTCCGGC-3′, where the nucleotides utilized as a complementary sequence for ligation-independent cloning are underlined.

Techniques: Construct

Journal: Applied and Environmental Microbiology

Article Title: Discovery of a Thermostable GH10 Xylanase with Broad Substrate Specificity from the Arctic Mid-Ocean Ridge Vent System

doi: 10.1128/AEM.02970-18

Figure Lengend Snippet: Sequence alignment of the C-terminal part of AMOR_GH10A and GH10 domains with known structures. The alignment includes CmXyn10B (PDB 1UQY) from Cellvibrio mixtus, SlXynA from Streptomyces lividans (PDB 1E0V), and TmxB from Thermotoga maritima (PDB 1VBR). The alignment is numbered according to AMOR_GH10A. Fully conserved residues appear in white on a red background, whereas less-conserved residues appear as red letters. The presumed catalytic residues are indicated by black stars. Subsite residues potentially involved in determining substrate specificity (see Discussion section) are marked by black squares.

Article Snippet: The amor_gh10a gene (codon optimized for E. coli expression) was synthesized by GenScript (Piscataway, NJ) and bp 55 to 1767 (omitting the predicted 18 amino acid signal peptide) was amplified by PCR using Q5 DNA polymerase (New England Biolabs, Ipswich, MA) and forward primer 5′- TTAAGAAGGAGATATACTATG GCTGAACCACAAGTTCCGGC-3′, where the nucleotides utilized as a complementary sequence for ligation-independent cloning are underlined.

Techniques: Sequencing

Journal: Applied and Environmental Microbiology

Article Title: Discovery of a Thermostable GH10 Xylanase with Broad Substrate Specificity from the Arctic Mid-Ocean Ridge Vent System

doi: 10.1128/AEM.02970-18

Figure Lengend Snippet: Effect of temperature, pH, and NaCl on the activity and thermostability of AMOR_GH10A. (A) Temperature dependency of activity at pH 5.6. (B) pH dependency of activity at 80°C. Reaction mixtures contained 0.5% (wt/vol) BGX, 2 µM AMOR_GH10A, and buffer supplemented with 0.5 M NaCl, and the reaction time was 10 min. (C) Effect of the NaCl concentration on enzyme activity at pH 5.6 and 80°C. (D) DSC thermograms with or without NaCl supplemented in the buffer. The protein samples (0.5 mg/ml) were heated at a rate of 1°C/min in 25 mM sodium acetate buffer (pH 5.6). The buffer baseline was subtracted.

Article Snippet: The amor_gh10a gene (codon optimized for E. coli expression) was synthesized by GenScript (Piscataway, NJ) and bp 55 to 1767 (omitting the predicted 18 amino acid signal peptide) was amplified by PCR using Q5 DNA polymerase (New England Biolabs, Ipswich, MA) and forward primer 5′- TTAAGAAGGAGATATACTATG GCTGAACCACAAGTTCCGGC-3′, where the nucleotides utilized as a complementary sequence for ligation-independent cloning are underlined.

Techniques: Activity Assay, Concentration Assay

Journal: Applied and Environmental Microbiology

Article Title: Discovery of a Thermostable GH10 Xylanase with Broad Substrate Specificity from the Arctic Mid-Ocean Ridge Vent System

doi: 10.1128/AEM.02970-18

Figure Lengend Snippet: Substrate specificity of AMOR_GH10A. (A) Time courses for the degradation of 0.5% (wt/vol) of phosphoric acid-swollen cellulose (PASC; blue), wheat arabinoxylan (WAX; gray), konjac glucomannan (KGM; yellow), birchwood glucuronoxylan (BGX; orange), or tamarind xyloglucan (TXG; green) by 2 µM AMOR_GH10A over 24 h. The reaction mixtures were incubated at 60°C in 25 mM NaOAc buffer supplemented with 0.5 M NaCl (pH 5.6). Background signals for reactions without enzyme were subtracted before calculating the amount of reducing ends using the DNS method and xylose as standard. (B) Zoom-in view of the first 2 h, revealing differences in the initial reaction rates. More details on the initial rates are provided in Fig. S3 and the main text.

Article Snippet: The amor_gh10a gene (codon optimized for E. coli expression) was synthesized by GenScript (Piscataway, NJ) and bp 55 to 1767 (omitting the predicted 18 amino acid signal peptide) was amplified by PCR using Q5 DNA polymerase (New England Biolabs, Ipswich, MA) and forward primer 5′- TTAAGAAGGAGATATACTATG GCTGAACCACAAGTTCCGGC-3′, where the nucleotides utilized as a complementary sequence for ligation-independent cloning are underlined.

Techniques: Incubation

Journal: Applied and Environmental Microbiology

Article Title: Discovery of a Thermostable GH10 Xylanase with Broad Substrate Specificity from the Arctic Mid-Ocean Ridge Vent System

doi: 10.1128/AEM.02970-18

Figure Lengend Snippet: Action of AMOR_GH10A on BGX. (A) Production of unsubstituted xylooligosaccharides (X to X6) generated from 0.5% (wt/vol) BGX by 2 μM AMOR_GH10A at 60°C (pH 5.6), determined by HPAEC-PAD. (B) Both unsubstituted and MeGlcA-substituted xylooligosaccharides in the reaction mixture after 24 h. The annotated m/z values indicate sodium adducts. None of the labeled peaks were observed in the negative control (i.e., a reaction without added enzyme).

Article Snippet: The amor_gh10a gene (codon optimized for E. coli expression) was synthesized by GenScript (Piscataway, NJ) and bp 55 to 1767 (omitting the predicted 18 amino acid signal peptide) was amplified by PCR using Q5 DNA polymerase (New England Biolabs, Ipswich, MA) and forward primer 5′- TTAAGAAGGAGATATACTATG GCTGAACCACAAGTTCCGGC-3′, where the nucleotides utilized as a complementary sequence for ligation-independent cloning are underlined.

Techniques: Generated, Labeling, Negative Control

Journal: Applied and Environmental Microbiology

Article Title: Discovery of a Thermostable GH10 Xylanase with Broad Substrate Specificity from the Arctic Mid-Ocean Ridge Vent System

doi: 10.1128/AEM.02970-18

Figure Lengend Snippet: Effect of acetylation on hydrolysis of birchwood glucuronoxylan by AMOR_GH10A. (A) HPAEC-PAD analysis of products generated by AMOR_GH10A from acetylated (blue) and deacetylated (green) birchwood glucuronoxylan. These substrates were generated in house and differ from the commercial BGX used in all other experiments in this study. Note that, to facilitate analysis, products generated from the acetylated substrate were subjected to a deacetylation protocol, prior to HPAEC-PAD. A standard sample containing xylo-oligosaccharides (XOS; X2 to X6) is shown in pink. Reaction conditions: 6 µM AMOR_GH10A, 5% (wt/vol) substrate in NaOAc buffer (pH 5.0), incubated for 24 h at 37°C at 800 rpm. (B) MALDI-TOF analysis of the products. The annotated m/z values indicate sodium adducts. None of the labeled peaks were observed in the negative control (i.e., a reaction without added enzyme).

Article Snippet: The amor_gh10a gene (codon optimized for E. coli expression) was synthesized by GenScript (Piscataway, NJ) and bp 55 to 1767 (omitting the predicted 18 amino acid signal peptide) was amplified by PCR using Q5 DNA polymerase (New England Biolabs, Ipswich, MA) and forward primer 5′- TTAAGAAGGAGATATACTATG GCTGAACCACAAGTTCCGGC-3′, where the nucleotides utilized as a complementary sequence for ligation-independent cloning are underlined.

Techniques: Generated, Incubation, Labeling, Negative Control

Journal: Applied and Environmental Microbiology

Article Title: Discovery of a Thermostable GH10 Xylanase with Broad Substrate Specificity from the Arctic Mid-Ocean Ridge Vent System

doi: 10.1128/AEM.02970-18

Figure Lengend Snippet: Sequence alignment of the CBM of AMOR_GH10A and CtCBM22-2. The alignment was obtained by superposing a structural model of the CBM of AMOR_GH10A and the crystal structure of CtCBM22-2. The sequence numbering refers to AMOR_GH10A. Conserved residues are printed in white on a red background, and conservatively substituted residues are printed in red. The predicted secondary structure elements of AMOR_GH10A are shown above the sequence alignment, where β-strands are rendered as arrows, and strict β-turns are represented by the letters TT. Positions marked by black stars represent CtCBM22-2 residues previously shown to be involved in ligand binding (66). The figure was constructed using ESPript 3.0. For clarity, the wild-type glutamic acid (E) is shown in position 138 of CtCBM22-2 (corresponding to A157 in AMOR_GH10A), thus replacing the alanine residue present in the E138A mutant of CtCBM22-2 that was crystallized (PDB 1H6Y).

Article Snippet: The amor_gh10a gene (codon optimized for E. coli expression) was synthesized by GenScript (Piscataway, NJ) and bp 55 to 1767 (omitting the predicted 18 amino acid signal peptide) was amplified by PCR using Q5 DNA polymerase (New England Biolabs, Ipswich, MA) and forward primer 5′- TTAAGAAGGAGATATACTATG GCTGAACCACAAGTTCCGGC-3′, where the nucleotides utilized as a complementary sequence for ligation-independent cloning are underlined.

Techniques: Sequencing, Ligand Binding Assay, Construct, Residue, Mutagenesis

Journal: Applied and Environmental Microbiology

Article Title: Discovery of a Thermostable GH10 Xylanase with Broad Substrate Specificity from the Arctic Mid-Ocean Ridge Vent System

doi: 10.1128/AEM.02970-18

Figure Lengend Snippet: Binding of the putative CBM from AMOR_GH10A to various insoluble substrates. The figure shows binding of the CBM to phosphoric acid-swollen cellulose (PASC) in light blue, Avicel in gray, birchwood glucuronoxylan (BGX) in orange, chitin in yellow, and ivory nut mannan (INM) in green. The CBM of AMOR_GH10A at 0.1 mg/ml was incubated with the substrates at 0.1% (wt/vol) for 60 min. The incubation was carried out at 22°C and 1,000 rpm in NaOAc buffer (pH 5.6) supplemented with 0.5 M NaCl. Bound protein was removed by filtration, and the remaining unbound protein was measured by A280. The absorbance values are shown as the percentage of the absorbance value for a control reaction without added substrate.

Article Snippet: The amor_gh10a gene (codon optimized for E. coli expression) was synthesized by GenScript (Piscataway, NJ) and bp 55 to 1767 (omitting the predicted 18 amino acid signal peptide) was amplified by PCR using Q5 DNA polymerase (New England Biolabs, Ipswich, MA) and forward primer 5′- TTAAGAAGGAGATATACTATG GCTGAACCACAAGTTCCGGC-3′, where the nucleotides utilized as a complementary sequence for ligation-independent cloning are underlined.

Techniques: Binding Assay, Incubation, Filtration, Control

Journal: Applied and Environmental Microbiology

Article Title: Discovery of a Thermostable GH10 Xylanase with Broad Substrate Specificity from the Arctic Mid-Ocean Ridge Vent System

doi: 10.1128/AEM.02970-18

Figure Lengend Snippet: Binding of the CBM from AMOR_GH10A to soluble substrates. The pictures show the result of acidic affinity PAGE with the soluble polysaccharides wheat arabinoxylan (WAX), tamarind xyloglucan (TXG), konjac glucomannan (KGM), and barley β-glucan (BG) and a control gel without added substrate. The proteins loaded were AMOR_GH10A_CBM (2 µg, right lane in each of the gels) and 2 μg of the reference protein, RNase A (left lane in each gel). The four gels to the right contained 0.1% (wt/vol) of the indicated polysaccharide. The ratio of the migration distance of the CBM in the presence of polysaccharide to that in the absence of polysaccharide was divided by the corresponding ratio for the reference protein and was below the cutoff value of 0.85 (67) in two cases, 0.67 for β-glucan and 0.82 for konjac glucomannan, indicating significant binding of the CBM to these two substrates.

Article Snippet: The amor_gh10a gene (codon optimized for E. coli expression) was synthesized by GenScript (Piscataway, NJ) and bp 55 to 1767 (omitting the predicted 18 amino acid signal peptide) was amplified by PCR using Q5 DNA polymerase (New England Biolabs, Ipswich, MA) and forward primer 5′- TTAAGAAGGAGATATACTATG GCTGAACCACAAGTTCCGGC-3′, where the nucleotides utilized as a complementary sequence for ligation-independent cloning are underlined.

Techniques: Binding Assay, Control, Migration